FiltersDone

Question type

Essay

Multiple Choice

Short Answer

True False

Matching

Exam 10: DNA: the Chemical Nature of the Gene

Show Answer

Share

---

All types

Filters

Study FlashcardsPractice ExamLearn

Question 21

Short Answer

Review LaterAdd Note

Review Later

What would be the sequence of an RNA produced by using the DNA sequence shown as a template? 3'-TACCGTGCGTGACATTAAGCC-5' Write the sequence from 5' to 3', left to right.

Correct Answer

Answered by ExamLex AI

To determine the sequence of an RNA stra...

View Answer

Show Answer

Question 22

Not Answered

Review LaterAdd Note

Review Later

List at least four errors in this drawing of two deoxyribonucleotides in a phosphodiester bond.

Correct Answer

verified

Show Answer

Question 23

Multiple Choice

Review LaterAdd Note

Which diagram shows a nucleotide that would be used to make RNA?

Which secondary structure of DNA would MOST likely be seen in a dehydrated tissue sample?

Summarize the evidence that RNA serves as the genetic material in tobacco mosaic virus (TMV).

Which term CORRECTLY describes the molecule below?

Which DNA modification is the addition of a -CH3 group?

What type of secondary structure is formed by the pairing of three strands of DNA?

A high-resolution X-ray diffraction technique was used to obtain detailed secondary structure of a DNA molecule. The characteristics of the DNA showed it was a left-handed helix with a general shape that was longer and narrower than the classic Watson-Crick model of DNA. Which form of DNA was resolved?

You are a researcher studying the genetic basis of colon cancer. You have been working with a colon cancer cell line to determine the expression levels of different genes that might contribute to cancer formation. You obtain the DNA methylation status of five genes of interest (the data are shown in the table below) . The plus (+) sign indicates the level of DNA methylation; more plus signs correlates with increased methylation levels. $\begin{array} { | l r r | } \hline \text { Gene } & \text { Methylation levels } & \\\hline 1 & + + \\\hline 2 & + + + + + \\\hline 3 & + + + \\4 & + + \\5 & +\end{array}$ Based on the information shown above, which gene would you predict to have the lowest rate of transcription?

How did Alfred Hershey and Martha Chase contribute to our understanding of DNA?

In the following DNA molecule, how many 3´ hydoxyls are present? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC

Which diagram shows a nucleotide with a purine base?

The bonds that connect nucleotides in a single strand are called _____ bonds.

In eukaryotic DNA, regions called "CpG islands" are often associated with unusual gene expression patterns, particularly decreased expression. What could be different about the DNA structure in these regions to account for decreased gene expression?

List four characteristics required of genetic material. For each characteristic, indicate how the structure of DNA helps us to understand the characteristic.

Which hypothesis contributed to the mistaken idea that protein is the genetic material because, with its 20 different amino acids, protein structure could be more variable than that of DNA?

Two double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double stranded. How might these fragments differ to result in different denaturation temperatures?

Draw the complementary strand to the following single-stranded DNA and label the 5' and 3'ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'.

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. What experiments would you perform to determine which of these three cellular constituents serves as the genetic material in your new organism?